teresaas1217 teresaas1217
  • 02-03-2019
  • History
contestada

what was the impact of the civil war on women and children

Respuesta :

Аноним Аноним
  • 02-03-2019

It was very difficult for them because in the household the father would provide for them "or the man of the house" since the men would go off to war there was no one to support the children and women because the women had to do house work they didn't work outside of their houses.

Answer Link

Otras preguntas

Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
i need help with #3
round 7,782 to the nearest hundred
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27