mango61 mango61
  • 04-04-2019
  • Advanced Placement (AP)
contestada

Explain bulk gaining industry

Respuesta :

mariahrjohnson mariahrjohnson
  • 05-04-2019
Ayeeee ap hug but bulk fainting industry is an industry that makes something that gains weight during production in factory that must be closer to the market because it’s too heavy to be farther from the market
Answer Link

Otras preguntas

A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
Step by step directions Square root for 480
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
what was paul revere failures
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
4.2meters= how many centimeter