dtwynn dtwynn
  • 04-02-2020
  • History
contestada

Only members of a political party can :

Respuesta :

dupeadesanmi5
dupeadesanmi5 dupeadesanmi5
  • 04-02-2020

Answer:Run for office in an election

Explanation:You have to belong to a political party where you may be nominated primary election and then run for office in a general election if successful

Answer Link
cambreiner12 cambreiner12
  • 06-05-2020

another answer is vote in a closed primary.

Answer Link

Otras preguntas

how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
A vehicle is only 15% efficient. What happened to the other 85%?
Please answer theses division problems!! 9 divided by 3/7
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Where did middle names come from
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article