Muhammed234 Muhammed234

01-06-2020
Mathematics

contestada

Please help me now plz I promise I will mark you brainliest

Please help me now plz I promise I will mark you brainliest class=

Respuesta :

HenryLCH HenryLCH

01-06-2020

Answer:

using section formula, B(-3, -3)

Ver imagen HenryLCH

Answer Link

Otras preguntas

How do the structures of alveoli and capillaries support the function of gas exchange?

Which correctly describes the reaction between potassium and excess water?

^5sqrt4x^2 ^5sqrt4^2

31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

__________ is widely considered to be the founder of the professional american police department.

Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6

Farmer brown built a rectangular pen for his chickens using 12 meters of fence. • he used part of one side of his barn as one length of the rectangular pen. • h

please help me if you can, thank you!