Shane98145
Shane98145 Shane98145
  • 01-08-2020
  • Mathematics
contestada

10 points will give brainliest, In the picture

10 points will give brainliest In the picture class=

Respuesta :

4jmath 4jmath
  • 01-08-2020

Answer: the correct answer is W or the first one

Step-by-step explanation:

All you do is transform the graph :)

I hope I helped, if i did please mark brainliest!! Thank you!!

Answer Link
xlemondrizzlex
xlemondrizzlex xlemondrizzlex
  • 01-08-2020
The answer is the first graph. Hope this helped!
Answer Link

Otras preguntas

On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
What is the range of function of y-1=(x+3)^2
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the bombing of Hiroshima and Nagasaki resulted in
Why were the committees of correspondence powerful?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds