LuvieAnn6117 LuvieAnn6117
  • 04-08-2020
  • English
contestada

Which word does the author use that he believes the spaceship metaphor is incorrect

Respuesta :

suhanashaik2005
suhanashaik2005 suhanashaik2005
  • 04-08-2020

Answer:

answer is dangerous

Explanation:

I hope this will help you

Answer Link

Otras preguntas

The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.
Why is plagiarism a violation of ethics? a. it makes psychology researchers look bad. b. it violates an apa standard. c. it is akin to lying. d. it violates a b
What is the conjugate acid of clo3 −? 1. hclo3 2. clo3 − does not contain oh−, so it is not a base and thus cannot have a conjugate acid. 3. hcl 4. clo− 4 5. h
What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Explain how infection prevention policies and guidelines can be applied in own work setting.
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
Definition: an event that is made up of two or more outcomes is called ____.
It is illegal for a minor to even attempt to purchase alcohol. a. True b. False
A cylinder is filled with 900 liters of water.find the area of its base if height of cylinder is 20dm.