jm2817495 jm2817495
  • 01-09-2020
  • Mathematics
contestada

Question /
Alice is three more than twice Emma's age. The sum of their ages is 48. How old is Alice?

Respuesta :

parallax420
parallax420 parallax420
  • 01-09-2020

Answer:

Alice is 33 years old.

Step-by-step explanation:

Alice is 3 more than twice Emma's age:

E = Emma

A = Alice

A = 3 + 2E

Sum = 48 years

So,

A + E = 48

(3+ 2E) + E = 48

3 + 2E + E = 48

3 + 3E = 48 (-3 both sides)

3E = 45

E = 45/3

E = 15

Emma is 15 years old.

A = 3 + 2E

A = 3 + 2(15)

A = 3 + 30

A = 33

Alice is 33 years old.

Answer Link

Otras preguntas

Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Tu as quels cours le jeudi matin?
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
What is the additive inverse of -4a
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5