laciparr2004 laciparr2004

02-11-2020
Mathematics

contestada

PLEASE ANSWER!!! i already have the first answer i just need the rest . im struggling so please .

PLEASE ANSWER i already have the first answer i just need the rest im struggling so please class=

Respuesta :

medjinapierre16 medjinapierre16

02-11-2020

Answer:

5) Alternate Interior Angles

6)Alternate Exterior Angles

7)Consecutive Interior Angles

8) 94

Step-by-step explanation:

Answer Link

Otras preguntas

Which sentence best describes how a business letter should be written? A business letter should have its body aligned to the right margin of the page. A busines

Firms can use one, no more than two, of five entry modes to enter into international markets. Exporting, Licensing, Strategic Alliances, Acquisitions, and newly

When a red blood cell is placed in hypertonic (very concentrated) solutions of nacl?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the density of a liquid that has a volume of 20.0 ml and a mass of 330 grams?

What do the tympanic membranes do for the frog?

(8n+1)(6n-3) please solve in quadratic formula

What was OPEC protesting when it imposed it's embargo?

what is the difference in length between a 1 and 1/4 inch button and a 3/8 inch button

Cuanto es (2x+2y=20) (-2x-6y=-52) con método de igualación y método de suma y resta