rachelseairayan
rachelseairayan rachelseairayan
  • 02-10-2016
  • Mathematics
contestada

8 39/40 show your work

Respuesta :

Аноним Аноним
  • 05-10-2016
20 remainder 9 is the answer
Answer Link

Otras preguntas

How do you find the length of the hypetnyuse if you have one angle and opposite side?
I=$310 P=$1,000 t=5 years
Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc
Which of the following best describes the rights given to the citizens of Jamestown by the Virginia Charter of 1606?
Which component of a phospholipid is found in the interior of a lipid bilayer?
Kira runs 3 miles in 28 minutes. at the same rate, how many miles would she run in 42 minutes
Throughout most of the war, southern forces suffered from a chronic shortage of food and supplies. a. True b. False
Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.
[tg.02]carbon in food molecules is transferred from animals to the geosphere through the process of
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat