umchileanwaysso umchileanwaysso
  • 03-12-2020
  • Mathematics
contestada

2m divided by 3/9; m = 3/2

Respuesta :

Lika232
Lika232 Lika232
  • 03-12-2020

Answer:

Not completely sure but I think 9

Step-by-step explanation:

In order to solve this equation, you would need to first multiply m by 2 to get 2 m. 3/2=1.5; 1.5*2 =3. 3/9 simplifies to 1/3

Then you would want to solve. So, you would need to divide 2 by 1/3 which would give you 9.

Answer Link

Otras preguntas

Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
Do all your pet's offspring look the same? If no, then explain why they look different.
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
4.2meters= how many centimeter
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
What Role Does the Sun Play in Producing Winds And Ocean Currents
how to i do 7/16÷(31/2÷1/2)