r682htwgmr r682htwgmr

01-03-2021
Mathematics

contestada

Which expression is equivalent to 4(2x +3)?

a.4 + 2x + 4 +3
8x + 12

c.8x + 3

d.
4 + 2x + 12

Respuesta :

zstumhofer zstumhofer

01-03-2021

Answer:

c 8x+3 all you do is multiply 4 and 2 to get 8 and add an x

Answer Link

Otras preguntas

(75) pointsPlease help me on these questions ASAP!!!

If two populations are isolated, they may become separate species because they are not longer ________.

U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?

Don’t know how to this, solve for x

According to Christian teaching, Jesus taught in ________________or short stories that used analogies to tell religious truth. Stories Analogies Metaphors Parab

The bretton woods system ended in select one: a. 1945. b. 1973. c. 1981. d. 2001.

Which weighs more? a.they both weight exactly the same. b.four protons c.two neutrons and two protons in a helium nucleus?

Please help me out with this

cody has 7/8 pound of cheese. he uses 1/7 since there are 16 ounces in a pound how much is left

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat