AliyahS123 AliyahS123
  • 02-03-2021
  • Biology
contestada

What is the theory of plate tectonics, and what are two ways this theory has been beneficial society?

Respuesta :

annaledford annaledford
  • 02-03-2021
the theory of plate tectonics is that at one point the whole word was once a big continent and were all connected. all the country’s easily connect like puzzle pieces
Answer Link

Otras preguntas

Which word has the long i sound? relieve speciality society social
what is 15/24 in simplest form
What is the additive inverse of -4a
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
What does hemostasis mean?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.