busychickn6521 busychickn6521

01-04-2022
History

contestada

Why do historians call the people who served in world war ii the greatest generation?.

Respuesta :

gothgirl16ad gothgirl16ad

01-04-2022

Answer:

because of their courage and working together

Explanation:

Answer Link

Otras preguntas

which of the following countries did the u.s. lend-lease military equipment to A. Germany B. spain C.great britian D.italy

During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, and some become part of the stomach, etc.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

great Britain is an example of a core nation True or False

What caused the gross domestic product of the united states to quadruple between 1860 and 1890?

What was the result of the anti-nephi-lehies becoming converted unto the lord?

Which of the following is not a characteristic of African music? A. A wide range of indigenous instruments B. Strong harmonic structures C. Complex rhyt

How did new industrial technologies influence the course of world war i?

A cat falls out of a tree and takes 1.4 seconds to land safely on its paws on the ground how many meters did the cat fall ?

What does the word "Islam" mean?