mamadeenayo1228 mamadeenayo1228
  • 02-04-2022
  • Chemistry
contestada

How much heat energy is needed to change 10 kg of ice at to water at ? , ,

Respuesta :

Аноним Аноним
  • 12-04-2022

we know that,

W = mL + mcθ

W= 10(336+ 4.2(50))= 5460 kJ

so quantity of heat required is 5460 J

Was this helpful?

Answer Link

Otras preguntas

Companies raise funds to expand their business by
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
how do i find the angles on a kite?
A vehicle is only 15% efficient. What happened to the other 85%?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A generator stores electric current. Explain why you agree or disagree with this statement
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
does radiation need a phase of matter to travel with?
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
who was the founder of Pennsylvania?