ethanhangyul
ethanhangyul ethanhangyul
  • 02-05-2022
  • Mathematics
contestada

Find the area of the shaded regions

Find the area of the shaded regions class=

Respuesta :

tarverquamyia
tarverquamyia tarverquamyia
  • 02-05-2022

your answer would be 254 I just did it and I got it right ✨

Answer Link

Otras preguntas

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Compliant is to stubborn as excited is to
does a human body use neon???
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Solve the equation -10 + 3x + 5x = -56 ? ??
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3