LoydV49637 LoydV49637
  • 03-11-2022
  • Mathematics
contestada

Unit cost of ring: $375Markup: 75%Retail Price?

Respuesta :

AspasiaM464473 AspasiaM464473
  • 03-11-2022

Answer:

[tex]Retail=\text{ \$656.25}[/tex]

Step-by-step explanation:

The retail price is represented by:

[tex]\text{ Retail= Cost*\lparen1+Markup \lparen as decimal\rparen\rparen}[/tex]

Therefore, by the given information:

[tex]\begin{gathered} Retail=375*(1+0.75) \\ Retail=\text{ \$656.25} \end{gathered}[/tex]

Answer Link

Otras preguntas

please explain this to me and what am i supposed to do 1. How did you use symmetry/asymmetry?
On April 2, Kelvin sold $80,000 of inventory items on credit with the terms 2/10, net 30. Payment on $60,000 sales was received on April 8 and the remaining pay
Help would be appreciated
What is the answer to:1+4=5 2+5=12 3+6=21 5+8=
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
A "home-made" solid propellant rocket has an initial mass of 9 kg; 6.8 kg of this is fuel. The rocket is directed vertically upward from rest, burns fuel at a c
Dutch agriculture is one of the most labor intensive types of agriculture in the world. Please select the best answer from the choices provided T F
If I like geometry, then I like math. Choose the equivalent statement
Newton’s first law is also called the law of ?
. Where are the reproductive parts of an angiosperm located? stems cones flowers fronds