ojozverdez5673 ojozverdez5673
  • 03-10-2017
  • Mathematics
contestada

What is the procedure for multiplying by a one digit number?

Respuesta :

KennedySHall
KennedySHall KennedySHall
  • 03-10-2017
Every time you multiply by a one digit number your answer gets higher. Hope that answers your question ^^
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?
Which is a characteristic of cancer cells? predictable, uniform cell division evidence of cellular cohesiveness uniform size and shape poor differentiation?
what is the answer and what does tan a mean
Solving this question
What law required Northerners to assist in the return of runaway slaves
Can someone please help me understand this?!?! i dont know what to even do. Write an equation for the line parallel to the given line that contains C. C(4,7); y
The sum of two numbers is 69. The larger number is three less than twice the smaller number. Find the numbers. Show your work.
Solve for x and y: x-3y=-8 3x+2y=31
What is the requirement when ratifying a proposed amendment to the United States Constitution? A. approval of three quarters of states in a state convention B.