kstaeCo3gCata kstaeCo3gCata
  • 02-12-2015
  • Mathematics
contestada

What was the greatest challenge cities faced as a result of rapid industrialization in the 1800s?

Respuesta :

W0lf93
W0lf93 W0lf93
  • 14-05-2017
The greatest challenge cities faced as a result of rapid industrialization in the 1800 was the dramatic increase in the number of the people that are moving into the cities. There was mass movement of the people from the rural regions into the cities where industries are located. This led to overcrowding in the cities.
Answer Link

Otras preguntas

A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the lcd of 10/11,29/44
Which word has the long i sound? relieve speciality society social
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
define concentric circles
what is 0.00001267 is scientific notation
What are the factors of 6x + 24?
This natural landmark was created by the natural forces of erosion. What is its correct name and location?