miguelmota0172 miguelmota0172
  • 01-02-2018
  • Physics
contestada

A tuna fish body is streamlined to reduce friction. Which describes the type of friction the fish must overcome?

Respuesta :

gabrieldroberso gabrieldroberso
  • 03-02-2018
The answer would be Fluid Friction
Answer Link
mccoya20 mccoya20
  • 04-12-2018

correct answer is Fluid Frictions


Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How to change 3 7/8 into an improper fraction
how would u form a superlative for the adverb widely
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
31+34=90-n 45+1=70-k 6×9=41+m
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
round 7,782 to the nearest hundred
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?