COUNTRYLELE3131 COUNTRYLELE3131

03-03-2018
Mathematics

contestada

The perimeter of a rectangular outdoor patio is 60 ft. the length is 4 ft greater than the width. what are the dimensions of the patio? l w

Respuesta :

itzelsantana00 itzelsantana00

03-03-2018

lengeth is 24 and with is 7

Answer Link

Otras preguntas

Cuales son los sustantivos del cuento la cigarra y la hormiga

Which artist determined that this new process changed the process of representing the observable world and how?

Read the list of rights below. Draw a graphic organizer with two columns. In the first column, list each of the rights below that you think Americans have today

Carl pays $79.99 for a Disney+ subscription every year. Because Carl It's such a Disney fanatic he also purchases the extra $30 per movie to gain early streamin

Four students are to solve 5(x-3)=2x+6 which solution and explanation is right?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Which is the following sum? 4√5+2√5 6√10 8√10

Olivia exercises for 45 minutes each day. How many minutes will she exercise during the month of July? (July has 31 days.)

13 - 2n = 27 Whats n?

What does space technology have to do with the 17 sustainable development goals of the United Nations? Identify specific instances or ways that the two are rela