johnnysteeler7986 johnnysteeler7986

02-04-2018
Chemistry

contestada

Why can two igneous rocks that have the same minerals but different names?

Respuesta :

preciadobrayan11 preciadobrayan11

16-04-2018

C. the rock may have diferrent textures

Answer Link

CaptainBoom CaptainBoom

11-09-2018

The correct answer is they can have different textures

Answer Link

Otras preguntas

The function y = 10 + 2.25(x - 4) can be used to determine the cost in dollars for a taxi ride of x miles. What is the rate of change of the cost in dollars wi

How does the legislative branch check the executive branch?

Which of the following is a fragment? A. The woman who had been our neighbor and family dentist for years. B. He liked it. C. The hotel only offered sweets and

Please answer this question right now

Whoever answers I’ll mark brainliest

kahalagahan kung bakit kailangan ang heograpiyang pantao

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

during a magic show, a magician quickly pulls a tablecloth off of a table set with dishes without disturbing the dishes. what law explains why the dishes did no

What were the interdependent relationships that you were able to observe?

what is chemical reaction ?